** THE "SPYING AT THE WALL" DICTIONARY ** * WORLDWIDE DISTRIBUTION * Last Update: $Id: spying.txt,v 1.15 1997/08/02 14:54:23 Barney Exp $ This document (The Spying at the Wall Dictionary) is in the public domain, to be freely used, shared, and modified. Send your own contribution or suggestions/corrections/comments to: yohanb@134.29.8.241 ** "Spying at the wall" Contributions ** ** HALL OF FAME ** GonTech Research, HardComp Research Inc., The First National Software Bank of Gleyson, Luidgi Trovattore Salvattore Ordinari Puglia Safadi Schiaffino, Artie-in-the-box, WeirdDreams Software, Soraggi, MagiX Solutions - V.Falcone, Ptialina Society Corporation, Alex Zepka, Joao Dovicchi, Marco Antonio Assfalk de Oliveira, Jason Mendez, Marcio Alesandro Rocha, Chris Baird, David Zanetti, Maria Rosario e Rogel, Dave Byter, Marcia Dalla Vechia, Andrew Bromage, Lesa Cafferty, Sander Goudswaard, Matthias Melcher, Trond Pedersen, Spitzenberg, Alexandre Oliva, Nicolas Vallee, Jessica Roop, Ricardo "Caco" dos Santos, Jerome Chik, Michel Eftimakis, Charlene Mirabella & Robert Boot, Evelyne Pichler, Renato Mitsuo Wada, Lennert Stock, Diogenes Pacheco de Melo, Matias Schweizer, Roland Hangg, Josemar Furegatti, Ron Lederer, Rodolfo Jose Leite Netto, Luciana Moutella Pimenta, Osvaldo Fernandez Junior, Luiz Azevedo, Emerson R. Zamprogno, jgs, Marcelo Malheiros, PooSung Park, Allen Mullen and everyone who has contributed to this dictionary. ====================================================================== [PEACEFUL ANIMALS -New] ,%%%%%%%%, %%/\%%%%/\%% _,._ %%%\C "" J/%%%, __.' _) %%%/ o o \%%%% .% <_,)'.-"a\ %%%| _ %%%% .%%` /' ( \'%%(__Y__)%%%%' %%` _.-----..,-' (`"--^ '%%%\-/`%%%%; \\ // | '%%%%%%%' \ )) (| `; , | | '. // \ ;.----/ ,/ | | / \ // ) // / | |\ \ | | ( \// \ \\`\ | |/ / __| | _\ / \ \\ \ | |\/ (((((((___________) `" `" `"` ----------------------------------------------- ,. ,. ,., / // / | |/\ (((((((~~~~~~~~~~~) / //,/ | |\ \ ~~| | ~/ \ ) \\ \ | |/ / | | ( /\\ / :'----\ `\ | | \ / \\ (| ,: ` | | .' \\ \\ | .%%%%%%%. / )) ~'-----''`-. (,.--v .%%%/-\,%%%%: // \. ( /.%%(~~A~~)%%%%. %%, <~`).'-.a/ %%%| ~ %%%% '%%, ~~'. ~) %%%\ o o /%%%% '% ~`'~ %%%/C .. 7\%%%` %%\/%%%%\/%% `%%%%%%%%` Lion and the Lamb spying at the mirror wall __, /; \ |; '\ |;' \^\ _________________________________|: ^,/\________________________ ') /\/ \,_ \/| \ (\_\ ) /\_\ _____/_/_/_/_ ( ,___, _/ /_ ) --""- """ / /_/_/ '"" /_o - - / (_(_(_ (_ | >) ( \_\_\\ _____ (___| _=' \' \_\_\\ / `----/ | _\__\_\_\\\_ , __/ \ |\ ( _, \_\_\\ ) /' |_ ,- _ \, \_____ \_ \-,,\_\_\' __,'_' '| _/__ \ \_____))) _) \ ',\\_'\_ __/.__,' /_____)))-----")______))) ,///---' '-,-\_\__/. __,' '-./_._.--' ~~ ~~~ ~ Spying Lion and Aligator spying at the wall __ /..\ ___ \_c==< (.)_(.).----. , /\_/\ /\/ \6 6/ `. |\_/-/ \-\_/\/ =\ /= ;~~~~~~~~~~~ _______\/_\/___\/_\/_________O_`mm-----mm'_______________ Snake and mouse spying at the wall _ ___ \.\'.\ '\ \__O__/ /` /_/_ .'''. \'\'.\ `--(_)--' =O(_)))) ...' `. __\.\:/_// .---/ \---. \_\ `. .''' -{{{{{(__(") / /'(>I<)`\ \ `..' `~~~~ >>>^ ` \ `-' / ' \ / _________________________________________________________ Bees and Spider spying at the wall __ /..\ ___ \_c==< , /\_/\ /\/ o |\_/-/ \-\_/\/ -|- _______\/_\/___\/_\/______/_\_____ Snake and child spying at the wall __ (\_ (_ \ ( '> ) \/_)= (\/) _________(_(_ )____(/\)__________________________________ Squirrel and butterfly spying at the wall ( )_( ) \. ./ /\-----/\ \\ _ =.= _ ( @ @ ) // -------m---"---m---o0o-=@=-o0o---- Another mouse and a cat spying at the wall. . * o . * o | . -O- . | * . -0- * o . ' * . o . . o | * * * -O- . . * | , . __|__ .---. --o--o--(_)--o--o-- = _/__~0_\_ . o ' = = (_________) . . * * . * - ) - * . . . . __|__ . --o--o--(_)--o--o-- * . * ________*____________*______________________________________ Planes and UFO spying at the wall ========================================================================= [THE VERY FIRST DAYS] ___m_oo_m___ Spying at the wall. ___m_OO_m___ REALLY spying at the wall. `' ___m_oo_m___ Spying (terrified) at the wall. \/ ___m_oo_m___ Spying (mistrustful) at the wall. ~~ ___m_oo_m___ Spying (surprised) at the wall. "" ___m_OO_m___ Spying (scared) at the wall. ___m_+o+_m___ Clown spying at the wall. ^^m^^oo^^m^^^ Spying at the wall with nails. ~^ ___m_-o_m___ Spying (tired) at the wall. ====================================================================== [ANIMALS] _ _ \ / ___m_O_O_m___ Mosquito spying at the wall. | * O O ___m_|V|_m___ Bird spying at the wall. v __ OO /||\ ___m____m___ Owl spying at the wall. / OO/ / / ** / /\ / / ___/ /_____ Dragon spying at the wall. . ----------- Ant spying at the wall. O..O ---,--"--,- Mouse spying at the wall. |\_/| |o o| --,---,^,---,-- Bat spying at the wall. / \ /VVV\ /V V\ |^^^^^| ___/_______\___ Jaws spying at the wall. . . '.-:-.` ' : ` .-----: A whale spying at the wall. .' `. , / (o) \ \`._/ ,__) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ __mmmm_oo_mmmm__ Octopus spying at the wall. __\/_oo_\/__ Crab spying at the wall. ____ /\ ..\/\ ---()-`----'-()--- Yet another crab spying at the wall. ( ) __w__(O O)__w__ Cow spying at the wall. U ____V@_____ Snail spying at the wall. (\/) ___(/\)____ Butterfly spying at the wall. __ \/ (_ \ ( '> _________(_(_ )______________________________________ Chick spying at the wall __m_(-O-)_m__ Koala spying at the wall. v v __m_.(")._m__ Pig spying at the wall. __m_.(%)._m__ Yet another pig spying at the wall. | o| |O | ____|___|____ Giraffe spying at the wall. V v ^ _____________ Far gulls spying at the wall. _____ / __<"> | | _____| |_____ Elephant spying at the wall. ______,________ Yet another ant spying at the wall. _____,P________ Ant with banner spying. ___,,,,,,,,,,,,,,,,,,___ Ants marching and spying at the wall. ___,,,,,,,,,,,,,,,,,P,___ Ant Platoon marching and spying at the wall. Y Y __w__(o o)__w__ Hart spying at the wall. y __ /..\__ / \ _ \ `____/ _ __/ \___|__|____/ \_____ Dinosaur spying at the wall. \_/ \_/ \/__ / \ /^ \ / __/\ \_ | / \ \ \/ | _| \ ____________/_____|______ Dino spying at the wall. ___ C ..\__ _ | 00\ _ __/ \_|_______/___/ \____ Hyppopotamus spying at the wall. \_/ \_/ ___ ___ / ..\__ / \ \/ V ___/_____\_|______/_______ Dromedaries spying at the wall. ___ ___ __ / ..\__ / \/ \ \/ V __/_____\___\|______/_____ Camel spying at the wall. ___ _____/)_)\______ _______(,),),)/_\,),),),)_______ Earthworm spying at the wall. // _// .. ~~-_ ___m<___m___~.___ Rabbit spying at the wall... _|__|__|__|__|__| |__|__|__|__|__|_ // _// oo ~~-_ ___m<___m___~.___ And the same rabbit after _|__|__|__|__|__| finding Babs Bunny sunbathing nude... |__|__|__|__|__|_ (Babs Bunny of "Tiny Toon Adventures" fame) .---. / 6_6 _ .-. \_ (__\ ("\ /.-.\ The Early Bird Catches // \\ `\\ // \\ the Worm! While (( )) \`-`/ \'-')spying on the wall. ============""===""=========="""======="""=== ||| | __, /; \ |; '\ |;' \^\ __________________________________|: ^, /\_______________ ') /\/ \,_ \/| \ (\_\ ) /\_\ _____/_/_/_/_ ( ,___, _/ /_ ) --""- """ / /_/_/ '"" /_o - - / (_(_(_ (_ | >) ( \_\_\\ _____ (___| _=' \' \_\_\\ / `----/ | _\__\_\_\\\_ , __/ \ |\ ( _, \_\_\\ ) /' |_ ,- _ \, \_____ \_ \-,,\_\_\' __,'_' '| _/__ \ \_____))) _) \ ',\\_'\_ __/.__,' /_____)))-----")______))) ,///---' '-,-\_\__/. __,' '-./_._.--' ~~ ~~~ ~ Lion and Aligator spying at the wall (seen from behind) ,%%%%%%%%, %%/\%%%%/\%% _,._ %%%\C "" J/%%%, __.' _) %%%/ o o \%%%% .% <_,)'.-"a\ %%%| _ %%%% .%%` /' ( \'%%(__Y__)%%%%' %%` _.-----..,-' (`"--^ '%%%\-/`%%%%; \\ // | '%%%%%%%' \ )) (| `; , | | '. // \ ;.----/ ,/ | | / \ // ) // / | |\ \ | | ( \// \ \\`\ | |/ / __| | _\ / \ \\ \ | |\/ (((((((___________) `" `" `"` ----------------------------------------------- Lion and the Lamb spying at the wall (_\_|___|_/_) (o o) \ / __m___O___m___ Moose spying at the Wall. ( )_( ) \. ./ ____m__=.=__m___ Yet another mouse spying at the wall. " (o)(o) / \ / | / \ * | / /\__/ / / ______/____/________ Yet another dino spying at the wall. (__) (oo) _____m__\/__m______ Cow spying at the wall. .---. .----------- / \ __ / ------ / / \(oo)/ ----- ////// ' \/ ` --- //// / // : : --- // / / /` '-- // //..\\ -----------UU----UU----- Eagle spying at the wall. '//||\\` ''`` | | | | | /\ | /\ //\\. .//\\ //\\ . //\\ / \( )/ \ _____________________ Spider spying at the wall. |\ _________|_\____________ Shark spying at the wall. ----- /\-----/\ \\ ( @ @ ) // ----o0o-=@=-o0o---- A Cat spying at the wall. |_| /_) _________// _______;;;;;;;;;;___________ Centipede spying at the wall. A/~~\A ((O O))___ \ / ~~~ (--)\ ------------------- Cow spying at the wall. |\ |\ \ \/~~\\ ~{{@ @}) ~ [ ] ~~~ ] ] /(__) ------------------- Horse spying at the wall. |\ |\ \ \ \ \ \ \ \ \ \ \/~~\\ ~{{@ @}) ~ [ ] ~~~ ] ] /(__) ------------------- Jackass spying at the wall. ,_ , /^\\ //\ | \\ // \ | || ,==. // | \ ||.=~////"=,|| / /(\ /////////\\\\\ /) (/(((///`~\\\\\)))\\///\ (//)))/_.-"")))\\((//((()) (((((((_.-"///"")).`')\\(\\ )))())' ((( ( './//))) (////~/ )) (((/(/ /)///` ( ))\(( `//(/_ '._ _.' _\\\ ((((/^\ '. .' /^\))) (\)\\__\ ' ' /__/(( )))\ ' ' /))) )//)/| ' ' |((( //))))/\ : : / )) (((((\\| : : | ( \\)\\\| : : | )))))| _.--'''--._ | ===========/(/// \.' _____ './====================================== (///( / .-': :'-. \ Yet another horse spying at the wall ))) \.' . . './ (( | . . | ) |/ '. .' \| //( )\\ \\/ \// `\ ''' /` '.__.__.' `"""` __, /; \ |; '\ |;' \^\ _________________________________ : ^, /\ ___________________________ ___[____]____[______]_____[_____] ') /\/ ___[____]____[______]_____ [____]____[______]_____[_____]____ \,_ \/| [____]____[______]_____[__ ___[____]____[______]_____[_____]__ \ (\_\ __[____]____[______]_____ [____]____[______]_____[_____]____[__ ) /\_\ ___]____[______]_____[__ ___[____]____[______]_____[___ _____/_/_/_/_ ____]____[______]_____[ [____]____[______]_____[____]_ ( ,___, _/ /_ ) ____]____[______]_____ ___[____]____[___ __""__ __ __""" / /_/_/ '"" _]____[____]____[___[_ [____]____[_____ /_o - - ____]___ / (_(_(_ ___]____[______]____[____ ___[____]____[_ (_ | >)_[_____ ( \_\_\\ _____]_____[____]____[__ [__ _____ [___ (___| _=' ___]___ \' \_\_\\ _]____[______[____]____ __ / `----/ | ____[__ _\__\_\_\\\_ ___]_____[__ ,_]____[_ __/ \ |\ [______( _, \_\_\\ ) ____]____[ /' ____]__ |_ ,- _ \, \_____ [___\_ \-,,\_\_\' [____] __,'_' __[____ [__'| _/__ \ \_____))) __ _) \ ',\\_'\_ __]__/.__,' _[____]_ __ /_____)))-----_)______))) ] ,///---' '-,-\_\__/. __,' [____]___ '-./_._.--' [____]____[_ ~~ ~~~ ~ Lion and Aligator spying at another wall |\__/| ____/| _ /| /\_/\ /\_/\ :\___/: /\_-_/\ \ O.O| \ o.o| \'o.O' = o o = ( o o ) \ O O / ( 0 0 ) --------------------------------------------------------------- Seven cats spying at the wall. @..@ (----) ( >__< ) ^^ ~~ ^^ -------------------------- Toad sitting on the wall. |\ /| \ Y/ |oo\ / \ .) -------W----------W-------- Kangaroo spying at the wall. ______2_2222_________ Ducks spying at the wall. __ (_ \ / / ___ / (_/ _ \__ _______\____/_\___)____ Snake spying at the wall. ___ / _ \ ___OOO__|_/_\_|__OOO__ Sea lion spying at the wall. \ \ /\ ( ) __(_o_)__ Babs Bunny spying at the wall. __ _U o\-- / ___/ / / / /\\ ___ \_/ /-\\-U o\__ | / __ ____/ | /| / || ____| |_| |___||____ Having fun and spying at the wall. o..o _______'____________ Monkey spying at the wall. " " /--\___/--\ _____ \/\ O o /\/ ___/ Bark\ ( o ) \ Bark/ -----U------------------- " A runaway dawg who spots his master and by an accident barks loud and clear so that the master spots his dog- spying at the wall." ._,=~~``~~=,_. .=` ~-. .-~ `-. /` / { } \ `\ | | _ \ / _ | | | / /@) )( (@\ \ / \ |; / \ ;| / \ | ; / __ \ ; \ / `"`/`\ ; (..) ; /`\ ` /` \{ /\ }/ `\ --------------------------------------- St. Bernard puppy spying at the wall _.="""=._ /` \ / `\ / / _} {_ \ \ / ; /o) (o\ ; \ \ | / _ \ | / \_/\| (_) |/\_/ /`\_/=\_/`\ /` `"` `\ { } ---------------------------------------- 'Like father like son' spying at the wall ...___..../\_ / _\ ,''', / _..., `\ , , / | \__\ . . / \ \ / ... ( ) | | = ________| _/_ | | = <__________\______)\__) ( = ) --------------------------------------------------- 'Circus dog' spying at the wall. . / V\ / ` / << | / | / | / | / \ \ / ( ) | | ________| _/_ | | <__________\______)\__) ----------------------------------- 'Free dog' spying at the wall. \^o^o/ ,^ ( ..) ----oOOo--| \ \--oOOo---- ```` \ `^--^ '''' \ \ \ ^--^ .oo0O O0oo. ( ) ( ) -------\ (-----) /--------- Aligator spying at the wall. \_)___(_/ ^\ |___| ` `^^^__ / `------' __ __ / \'''/ \ / (O O) \ +-------------------------------------oOO-( )-OOo----------------+ | ( ) | | \\ | | ~ | Elephant spying on the wall. _--_ _--_ /#()# #\ 0 0 /# #()#\ |()## \#\_ \ / _/#/ ##()| |#()##-=###\_ \ / _/###=-##()#| \#()#-=## #\_ \ / _/# ##=-#()#/ |#()#--==### \_ \ / _/ ###==--#()#| |#()##--=# #\_ \!!!/ _/# #=--##()#| \#()##---===####\ O|O /####===---##()#/ |#()#____==#####\ / Y \ /#####==____#()#| \###______######|\/#\/|######______###/ ()#O#/ ##\_#_/## \#O#() ()#O#(__-===###/ _ \###===-__)#O#() ()#O#( # ###_(_|_)_### # )#O#() ()#O(---#__###/ (_|_) \###__#---)O#() ()#O#( / / ##/ (_|_) \## \ \ )#O#() ()##O#\_/ #/ (_|_) \# \_/#O##() \)##OO#\ -) (_|_) (- /#OO##(/ )//##OOO*| / | \ |*OOO##\\( |/_####_/ ( /X\ ) \_####_\| ______ /X/_\__/_______\___/_______\__/_\X\_________ (#/ \#) Butterfly spying at the wall. V7~~7V {oo} / \ _ooOO_(=()=)_OOoo_____ Dog spying at the wall. '''' ~~U~ '''' )\ ( ) /( sS* s S )-(0^^0)-( S*S*sS*s )/ \\// \( s*Ss*s*S (oo) s*Ss*s*SS* _____oOo__~~__oOo_____ Dragon spying at the wall. ^.__ \__|| ________((__\\________ Chihuahua dog spying at the wall. |\__/,| (`\ _.|o o |_ ) ) ---(((---(((---------- Cat spying at the wall. \\\\\\\\\ ____ >|||||||||#> ___ Dead fish spying at the wall. ///////// (It was eaten by the cat...) >-\ \\\\ >=\ | //// | ________<*LLLLL>=-/______ Scorpion spying at the wall. | \\\\ >-/ //// o o _< - >_ ---------------- Frog spying at the wall. _<^*^>_ ----------------- Dead Frog spying at the wall. ,--,__ _ ___/ /\| ,;~( )__, ) ~ // // '==; ' \ | ^ _________^____^_______ Unicorn spying at the wall. _____________ / _ _ _ \ ||||| / /_\ /_\ /_\ \------( . . ) _/_________________\________O_____ Turtle doing nothing and spying at the wall. ================================================================= [FAIRY TALES] __m___o_o_____m__ Rapunzel spying at the wall. () () () () () () () () () () X X ___m__@^@__m___ Rapunzel with glasses spying at the wall. () () () () () () () () () () X X *_ ^ | ~~\ | | ./ | (*) |~~ | _<">_ | o+o \ / \0 0'\ ^ /\/ / \ | /__^__\| || || | || || | ____d|_|b_T_______ Sir Lancelot spying at the wall. .-" .-. "-. _/ '=(0.0)=' \_ /` .='|m|'=. `\ \________________ / .--.__///`'-,__~\\\\~` / /6|__\// a (__)-\\\\ \ \/--`(( ._\ ,))) / \\ ))\ -==- (O)( / )\((((\ . /))))) / _.' / __(`~~~~`)__ //"\\,-'-"` `~~~~\\~~`"-. // /`" ` `\ ===================================== Pirate spying at the wall ____ |__|| __|_/ _|_| |__| __|| _|_L________m__o_o__m_______________ Spying at the castle wall. |__|__|__|__|__|__|__|__|__|__|__| __|__|__|__|/ | | |\_|__|__|__| _|__|__|__|| | | | |__|__|__|__| |__|__|__|_|__|__|__|_|_|__|__|__| _______________________________________ ____ |__|| __|_/ _|_| |__| __|| /\ _|_L_________m/..\m_________________ Merlin spying at the castle wall. |__|__|__|__|__|__|__|__|__|__|__| __|__|__|__|/ | | |\_|__|__|__| _|__|__|__|| | | | |__|__|__|__| |__|__|__|_|__|__|__|_|_|__|__|__| _______________________________________ ____ |__|| __|_/ _|_| |__| __|| /\ _|_L_________m/..\m________________ Merlin spying at the castle wall |__|__|__|__|__|__|__|__|__|__|__| and casting a spell to open the __|__|__|__|/ \_|__|__|__| gates. _|__|__|__|| |__|__|__|__| |__|__|__|_|__________|_|__|__|__| / \ ________ / \___________ /________________\ ====================================================================== [THE SIMPSONS] __&__ / \ | | | (o)(o) C .---_) | |.___| | \__/ /_____\ /_____/ \ / \ -------------------------- Homer Simpson spying at the wall. (####) (#######) (#########) (#########) (#########) (#########) (#########) (#########) (#########) (o)(o)(##) ,_C (##) /____, (##) \ (#) | | OOOOOO / \ -------------------------- Marge Simpson spying at the wall. /\ /\ /\ | V \/ \---. \_ / (o)(o) <__. _C / /____, ) \ \ /----' ooooo / \ -------------------------- Lisa Simpson spying at the wall. /\ .----/ \----. \ / .--\ (o)(o) /__. \ () / > (C_) < /___\____/___\ /| |\ / \ -------------------------- Maggie Simpson spying at the wall. ___ ______ .'/,-Y" "~-. 1.Y ^. /\ _\_ i ___/" "\ | /" "\ o ! 1 ] o !__./ \ _ _ \.___./ "~\ X \/ \ ___./ ( \ ___. _..--~~" ~`-. ` Z,-- / \ \__. ( / ______) \ 1 /-----~~" / Y \ / | "x______.^ | \ j Y -------------------------- Homer Simpson spying at the wall. |^^^^^^| | | | | | (o)(o) @ _) | ,___| | / /___\ / \ ------------------------- Bart Simpson spying at the wall. _ ( | | | | | | | --m--oo--m-- Marge Simpson spying at the wall. |\|\|\ | oo | Bart spying at the wall. --M---------M-- .. --m--O--m-- Maggie spying at the wall. ___ ( ) ( ) ( ) Marge Simpson spying at the wall. o o --m-----m-- ====================================================================== [HEROES] ____________ Invisible Man spying at the wall. ~~~~~ / S / / / ___m_oo_m___ Super Man spying at the wall. __m__(((..)__m__ "Monica" spying at the wall. _\|/_ __m__(. .)__m__ "Cebolinha" spying at the wall. MMM MMM \ \ / / \ \/ / \ / \ / o o __m__V__m__ Batman spying at the wall. . -- . ( ) ( (/oo\) ) ( \''/ ) WW ( \/ ) wwwwww /__\ ( ) w"ww ww"w | oo | _WWWWW_ ( ) W o""o W (o)(o) (|_()_|) / o o \ oo ( )W ______ W w" "w \__/ (| __O__ |) w"()"w ( ) "w \_\/_/ w" W -====- W /|\/|\ \ \___/ / "wwww" = = |||||||||||| w""""""""""w |||||||||=========| w" "w = = ||||||||||||W W|||||||||=========| ---------------------------------------------------------------------- Sesame Street spying at the wall. . . _-xXXXXx_ "Watch and you'll see... x. x /XXXXXXXXX\ Someday I'll be... |X\_ _/X| __--XX| o o|XX| Part of your world" o. |XXXXXXXX| .XXXXXX| / |XXX| .O \XXXXXX| /XX.---_X\ ~ /XXXXX| oo `XXXX| ==__----____- \/ xXXXXXX. . O \XXX| ----_____-. xXXXXXX/ . \XXXx. _-xXX\ "xXX- . |XXXXx_ __-- \XX|_ / / . ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ The little mermaid spying at the wall __ _-==-=_,-. /--`' \_@-@.--< `--'\ \ <___/. \ \\ " / >=\\_/`< ____ /= | \_|/ _' `\ _/=== \___/ `___/ //\./=/~\====\ \ // / | ===: | ._/_,__|_ ==: __ \/ \\ \\`--| / \\ | _ \\: /==:-\ `.__' `-____/ |--|==: \ \ ===\ :==:`-' _> \ ===\ /==/ /==\ | ===\__/--/ <=== \ / ====\ \\/ _`-- \/ === \/--' | \ ==== | ________ -`------/`--' /___ Tiger spying at the wall. \___-' ____ / \ / (O) (O) \ | | | \ / | \ |\__/| / \ \ \__/ / / __0_0_0_______/ \ ____ / \_______0_0_0_____ Barney spying at the wall. ._ / ______ / _/ /______\ / |(0) (0) | /\________/\_ / _____ \ | / \___/ \ | ____0_0_0______\ __________ /____0_0_0_________ Teenage mutant ninja turtle spying at the wall. ,())))), ,()))))))),. ,---,,,_ ()))))))//((\ ( )) (\\( \))( \(/) ( ) /( \\ heh-heh >> ( ) // _ \ hey Beavis,>> (_(_(((( ) // \ / \ Watch! << ( , \ ) \ (. .) \ / | / ) ) (, | ,) / yeah. >> << |\ / ( ) \ ^\/^ / / that's COOL! hey, (.(.) S ) \ / Butt-Head...you're /_ \ ) \ (-<>-) / an "ASS-kee." \ /__) ^ \/ \ -- / >>heh-heh<< /____/ | \ __ / (______ | | | \ | __-|__|-__ __-\__|-__ ( ) ( ) |_|AC//DC|_| |_|METALL|_| | | | | | | | | //\/\\/\//\/\//\/\\/\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\// >//\/\\/\//\/\//\/\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/ //\\/\//\/\\/\\/\//\//\/\///\/\\/\//\/\//\///\/\\/\//\/\//\/\//\/\\/\//\/\ //\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\////\/\\/\//\/\// >//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\ //\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/\\//\/\\/\//\/\//\/ Beavis and Butt-Head spying at the wall ====================================================================== ____ o8%8888, o88%8888888. 8'- -:8888b 8' 8888 d8.-=. ,==-.:888b >8 `~` :`~' d8888 88 ,88888 88b. `-~ ':88888 888b ~==~ .:88888 88888o--:':::8888 `88888| :::' 8888b 8888^^' 8888b LS d888 ,%888b. d88% %%%8--'-. /88:.__ , _%-' --- - i '''::===..-' = --. ` [""""]""""[""""""]"""""["""""]"""""]""""]"""" """[""""]"""""["""""]"""""]""""""]"""["""""]" """]""""[""""""]"""""["""""]"""""]""""]"""""[ "[""""]"""""["""""]"""""]""""""]"""["""""]""" Mona Lisa spying at the wall. ====================================================================== [SPACE] oo || ___m_OO_m___ Alien spying at the wall. __ ___m_[..]_m___ Robot spying at the wall. OO /||\ ------ ___m_||_m___ Darth Vader spying at the wall. ________ | O O | \ / ---- || E.T. spying at the wall. || --///------\\\-- /// \\\ ooo ooo |o| |o| ____________ Imperial Tie fighters spying at the wall. |o| |o| (o) __________________ Imperial Tie fighters and Darth Vader ship spying at the wall. _________@@__________ imperial AT-AT spying over the wall of the Hoth rebel base (pun intended). _____ / ___ \=[]_ \\ \\ ________//__//_______ O.K., here's the AT-AT spying at the wall. || || || \||/ -[]- /||\ || || == EE //EE\\ // \\ ------------------------- Luke Skywalker while levitating upwards to spy at the wall, holding lightsaber as seen on poster. ___ / o \ ---------------------- R2-D2 spying at the wall. ___|(- / o \ ---------------------- R2-D2 spying at the wall, using his sattelite dish, too. __ |**| ---------------------- Jawa spying at the wall. A / \ o / / \ /\ __/___\______\ \____ Vader and Luke saberfighting and spying at the wall. _____ (@___@) _____oooO___| |__Oooo_____ E.T. spying at the wall. ====================================================================== [THE WORLD] ___m_--_m___ Chinese spying at the wall. ooo __m_--_m_c| |__ Chinese spying and drinking at the wall. [] ------ ___m_oo_m___ Mexican spying at the wall. . o o Indian Guru spying at the wall. --m-----m-- . Indian Guru spying at the wall using --m-----m-- his third vision only. (___) o o Viking spying at the wall. --m-----m-- .. ooo __m_--_m_c| |__ Chinese spying, drinking and smoking at the wall. ./ 6 o ___M_ 0 _M___ The Chinese vomiting at the wall. .!` ', z z z ___m_--_m___ The same Chinese hangover at the wall... *** &/***\& (((ooooo))) /@'.''.''.'@\ ((oo((( )))oo)) ((? . . "?)) -" __ "- "\__ __/" " [] " /# #\/# #\ / \ / / \ ___________________________ Japanese Princess spying at the wall. _________ | | ____|________|____ //// _____) _| (o)(o) (o \| | (..) | /||||\ | \ \\ | ----__\\__ ) ( ____________( )_______ Gaucho spying at the wall. \ / \__/ || \/ ////--\\\ /// 0 0 \\\ \ " / ______mm__\_~_/__mm______ Indian spying at the wall. / \ _______/xxx\________ \__________________/ _____m__\_o_o_/__m_______ Little mexican boy spying at the walll. (mexican accent) (BBBBBBBBBBB) (BBB @ @ BBB) (BBB U BBB) (BBB ___ BBB) _m__(BBB_\_/_BBB)___m__ Rastafari spying at the wall. _____ __| |____ / \ /_______________\ | | ( (..)| | B | ___| | \__----@ _______|_________|_________ Backwoodsman surprised in the wall. _\|/_ | | | | |_| @@@@@@@@@|-|@@@@@@@@@ @@@@@@( )@@@@@@ @@@@@@@( 0 0 )@@@@@@@ @@@@@@@@( U )@@@@@@@@ @@@@@@@@@( _____ )@@@@@@@@@ @@@@@@@@@@( \___/ )@@@@@@@@@@ ) ( ) ( ) ( ) ( ) ( _____m__________)_______(_________m______ Yet another indian spying at the wall. ====================================================================== [SPORTS] o=====o=====o\ 0 __ |\ :. . . \._/_\ _>_ __|_`o=====o=====o__ /|____ Playing snooker and spying at the wall. | | | | | | o o o o o o o o o o o o \/) _(\____/_)/_)/_)/_)/_)/_)/_)/_)/_)/_)____\_____ ______\___/__/__/__/__/__/__/__/__/__/________\ /_______ \ Rowing and spying at the wall. ._ O ________________ //\. \>> | \\ Skiing and spying at the wall. *** *** \o **** \ |\ ****** << ******* \ ----------------- Surfing and spying at the wall. \e/ __o __o I `\<, `\<, `\\, _O/ O_________O/_O______O/_O_ Biking and spying at the wall. o /| o o \|=-- o ## \\ / \O O_/ T T /| |\ | | _______________|_|________ Playing basketball and spying at the wall. |\ |-\ |--\ |---\ |----\ |-----\ /|------\ / |-------\ /| |--------\ /-| |---------\ /--| |----------\ /---| |-----------\ /----| |------------\ /_____| |-----O-------\ / |____/ \____|___-\ \------------------------| | \ | ----------------------------- Sailing and spying at the wall. \ \ O, (_______\/ )_______/ -----------\-------------- Rowing and spying at the wall. \ o \ o / _ o __| \ / |__ o _ \ o / o /|\ | /\ __\o \o | o/ o/__ /\ | /|\ / \ / \ | \ /) | ( \ /o\ / ) | (\ / | / \ / \ ------------------------------------------------------------------- Aerobics and spying at the wall. o o o O `\/Y\/~ ____/_\____ Playing with balls and spying at the wall. o /\O/ O 0 \\ | 0-# _____//____________|____________/_\______ Playing tennis and spying at the wall. _ o /\ \__/ ___________|_\__/ /o Jumping and spying at the wall. \ / | /o\ %%%%%%%%%%%%%% %%%%%%%%%%%% _\ ~~ ~ %%%%%%%%%%%%% > ,___ %%%%%%%' _` / _==. __/ /____/ | /_ ~ ~~ / _________| <^)(((=( ~ \ .) ) " _\ \ ( ~ ~~ )=)))(^> \ ,%*%%%%%%*%%-._ " \%%%%*%%%*%%%%/ ) ~~ ~~ %*%%%%%*%%%*/ /| ~ `*%%*%%%%* | / | ~~ ~ ______________________________ |/ \| / /| /| \| |/ ' Speed jumping at the wall _ _| |_ |_ _| | | | | / \ | | | | ------------- RIP and spying at the wall. (after the jump...) 0 _ ii / \ `O __iiii______________ /|____ Bowling and spying at the wall. iii | \ i o _ 0 .-----\-----. ,_0 _ o' / \ |\ \ \ \ `o __|\___|_`-----\-----`__ /|____ Playing table tennis / | | | | \ and spying at the wall. | | , yeah , \ / / \0 0/ |\/ \/| | | / \ / \ ____/___\______/___\_________ Working out and spying at the wall. , yeah uhoo \ / / \0 O .. |\_ \/|\_o[] | | / \ / \ ____/___\______/___\__________ Working out, drinking beer and spying at the wall. no ops 0 / / \/|\__ | _ _ / \ \ / ____/___\___________\ /_______ Working out, falling down and | spying at the wall. | o[], /O\ @@ / \ @ _______________________________________________________ o o o o o Scuba diver spying o under the wall. o ______ ______ _ *o(_||___)________/___ O(_)( o ______/ \ ^ `/------o-' \ *____/ \o |\ << ------O------ Monobiking and spying at the wall. ! O) O) `\ O O /`\| //`-< \\ . /`\\> _>>____`Z_______/<__________________________________/<__ Playing baseball and spying at the wall. __==~^~~===-_ _==~ ~~##==_ === | | , / #### \ \ | |' / / #### \ \ | | / / / / ` \| |/ / / ,' \ | | / ,',' \ | | /,' ,' \` ;/' ,' \` / ,' |o| ' _X' || ---------''----------------- Para spying at the wall. O o / {"#v --v#"' /'> <`\ ----------------------- Fighting and spying at the wall. ____| o \%/ |~~\ o// | 8 | / > | ~ ~ ~~~~~~ ------------------------ Playing basketball and spying at the wall. /~\o /-() -- - - \_/ \\/ ) -- - -- Biking funny and spying at the wall. |/_\ -- - -- - \_/ . . . ........ ------------------------------------- ====================================================================== [GAMES] ____ / \ | * *| ____|/\/\/\|_____________ Inky spying at PacMan at the wall. ____ / \ -----| ==<------------ Pacman is eating the wall !!!! \____/ ____ / \ |o o | ____|/\/\/\|_____________ PacMan ate a pill and Inky is running from the wall. HI323109 PL1: 234513 o o o o o o o o o * * * * * * * # # # 0 # # # # | . . __________/\_____________ Space Invaders spying at the wall. ______ | O | | _ _ _ _ N _ A _ _ _ E _ A _ _ ___|________________________________________ Playing Hangman and spying at the wall. (Hint: it's a ASCII joke...) @@ @@@@ @@ ## <> ######<> [][][][]<> <><><><>[][][][]<> ------------------------ Tetris spying at the wall. | | | | 000 | | 11111 | __m_|__2222222__|_m_______ Towers of Hanoi spying at the wall. ====================================================================== [WEIRD OBJECTS] __ / | _O - - || \ _____||_____ Periscope spying at the wall. (( --|-- )) --|-- --|-- | ___m_|_m___ Ham Radio spying at the wall. ====================================================================== [BIZARRE] ____ | -- | || || | -- | |. --| |____| ______ Macintosh spying at the wall. |::::::| ------ _ -\---------|"|- \ - . . \ / \/ +----+ | .| | OO.| ___m_|____|_m___ TV spying at the wall. ~ ~ /\ __ / \|| / \| / ___ \ | | | | | |.| | ___m_|_|_|__|_m___ House spying at the wall. o -|- ___/_\_____ Childish drawing spying at the wall. __/\__ \ / __/\__/ \__/\__ \ / /_ _\ \ / __/\__ __/ \__ __/\__ \ / \ / \ / _/\__/ \__/\__/ \__/\__/ \__/\__ ----------------------------------------------------- Fractal spying at the wall. /|\ ||||| ||||| /\ ||||| |||| ||||| |||| ||||| /\ |||| ||||| |||| \|`-'|||| |||| \__ |||| |||| ||||`-'||| |||| ___/ ||||| ||||| ----------------- Cactus spying at the wall. /\ / \ \ \__ \ \o\ ________\___\o\___ Sinking and spying at the wall. ) \ / ( /|\ )\_/( /|\ / | \ (/\|/\) / | \ ____/__|__o____\`|'/___o__|__\______ Lucifer spying at the wall. '^` \|/ '^` V \/ /\ / \ / \ _______/__/\__\__________ Indian house spying at the wall. \/ \/ \/ /\ /\ /\ _______/__\/__\/__\___ Indian Village spying at the wall. . . . + . . . . . . # . . . . ### . . . . . "#:. .:##"##:. .:#" . . . . "####"###"####" . . "#:. .:#"###"#:. .:#" . . . . "#########"#########" . . . "#:. "####"###"####" .:#" . . "#######""##"##""#######" . ."##"#####"#####"##" . . . "#:. ... .:##"###"###"##:. ... .:#" . . "#:. ... .:##"###"###"##:. ... .:#" . . . "#####""#######""#####" . . . " 000 " . . . . . 000 . . . -----------------------00000----------------------------------- Christmas tree spying at the wall. CGATTAGACACAGAGATATGGGCAA ||||||||||||||||||||||||| _____GCTAATCTGTGTCTCTATACCCGTT______ DNA sequence spying at the wall. ________ | | | | ____| |__________________ "Baloon" spying at the wall. `----. .-' |/ __________ | | |______(*)_| /\__----__/\ /_/()||||()\_\ |_\ o||||o /_| _________|----JeeP----|________________________ |_| |_| Jeep getting thru and spying at the wall. __|__ --o--o--(_)--o--o-- ------------------------------ Flying and spying over the wall. __o _ \<;_. Bike on the wall. ______ (_)/ (_) ___________ | _________ | ------- || || | | || || | | || || | | ||_________|| | | m_ \ /____|_______|___m__ Computer spying at the wall. --------8<----m-oo--m--------- Cut here in order to spy at the wall. +-------------+ /| /| / | / | / | / | / | / | +----|--------+ | | | | | | | | | | +--------|----+ | / | / | / | / | / | / |/ |/ +-------------+ ---------------------------- Cube spying at the wall. +-------------+ /|\ /|\ / | +---------/-|-+ / |/| / |/| / / | / / | +---/|-|------+ /| | |\ / | | |\ / | | | +--|-|------|-+ | | | | +-|------|-|--+ | | | / \| | | / \| | |/ +------|-|/---+ | / / | / / |/| / |/| / +-|-/---------+ | / \|/ \|/ +-------------+ ---------------------------- Hypercube spying at (?!?) the wall. ________ (_______(| | || | How || | to || | Spy || --------|_______|------- Book spying at the wall. _ _ //| //| // | // | // ////////////// | // ////////////// | _ _ // /////////////-| | //| //| // ////////.---'-;| | // //////// | // ////////;;;;;-;;| | // //////// | // ////////;;;;;-;;;| | // //////// | // ////////.---'/|;;;| | // //////// |_ // ////////////// |;;;| | // //////// //| // ////////////// |;;;| | // //////// // //|~~~'''----'''~~| |;;;| | // //////// // ///| | |;;;| | // //////// // ////|===============| |;;;| | // //////// // /////| Ye Olde Magic | |;;;| | |~~~~~~~~| // //////| Book | |;;;| | /| | // ///////|===============| |;;;| | //| The | // ////////| | |;;;| | ///|Complete| // /////////| | |;;;| | ////| Works | // //////////| | |;;;| | |~~~|| of |// ///////////| | |;; | |THE|| ||~'---..---'~|| Calculus IV | |; | |SPY|| The || Barney's || For the | |' | |LAW|| Spies || Guide to || Spies | | | | || || the || | | | || || || | | | || || * ***** || | /| | || || * * * || | //| | || || **** * || | // | | || || || | // | | || || ******** || | // | | || || * * || | // | | || || ***** || | // | | || || || | // / | || || ****** * || | // / | || || || | // / | || || ******** || |// / | || || * * * || |/ / | || || * * * || | / | ||Yohannes|| ||---------------| / |...||Barnabas|| * ***** || 5th Edition | / |...|| & || * * * ||---------------| / | || Howe || **** * || | / |___||________||____________||_______________|/_______ The spy library spying at the wall. ___ ,,==/ \ // /-----\ // || / \ | O| _______|__|_____________ Stand lamp spying at the wall. ___ ,,==/ _ \ // | (_) | // \___/ || / \ | O| _______|__|____________ Stand lamp spying frankly at the wall. /| / | / | / | / O | ______/_____|___________ Set square spying at the wall. /~\/\ / O | ______/_____|___________ The same set square spying at the wall. (Caught and broken by stone) ====================================================================== [RESTING AND SPYING] .o___/\ /\```````/\ ------------------ Sleeping and spying at the wall /\ /\ ____:^)-----<__L____ Resting and spying at the wall. \/ \ \_ /\ /\ ____:^?----<__L____ Resting, smoking a pipe and spying at the wall. \/ \ \_ /\ /\ ___*<:^)----<__L____ Resting, wearing a Santa Claus hat and spying \/ \ at the wall. \_ /\ /\ _OOOO:^)----<__L____ Marge Simpson resting and spying at the wall. \/ \ \_ /\ /\ ____@:^)----<__L____ Resting, wearing a turban and spying at the wall. \/ \ \_ /\ /\ ___=:^)----<__L____ Punk Rocker resting and spying at the wall. \/ \ \_ /\ /\ __C=:^)----<__L____ Chef resting and spying at the wall. \/ \ \_ w \ \ /\ ____:^D-----<__L____ Resting, saying "Hi" and spying the wall. \/ \ \_ ooo c|_| /\ ____:^D-----<__L____ Resting, drinking and spying at the wall. \/ \ \_ ,_ O \ /\ ____:^O-----<__L____ Resting, eating an apple and spying at the wall. \/ \ \_ _____ \ \ \ P_\__\ /\ ____:^D-------<__L____ Resting, reading the newspaper and spying \/ \ at the wall. \_ _____ \ \ \ P_\__q /\ ____B^|-----/--<__L____ Resting, reading the newspaper (with glasses) \/ \ and spying at the wall. \_ \|/ -( )- /|\ /\ /\ ____B^)-----<__L____ Resting (under the sun) and spying at the wall. \/ \ \_ w / / /\ ____B:^( -----/==L==/____ Resting (but the sun has gone for a while) \/ and spying at the wall. w \ \ /\ ____B^D-----<__L____ Superstar resting and spying at the wall. / \ / \_ m ? \ / /\ ____ >:^) -----/==L==/___ Captain Hook resting, saying "Hi" and \/ spying at the wall. /\ /\ ____:^)-----<__L____ Rapunzel resting and spying at the wall. ()\/ \ () \_ () () () X *-w- \ / /\ ____:^)-----<__L____ Rapunzel resting, dreaming about the () \ \ Enchanted prince and spying at the wall. () \ \_ () m () () X /\ /\ ____%^|-----<__L____ Tired of lying at the wall. \/ \ \_ ====================================================================== [EFTIWALL FONT] This is a Figlet font created by Michel Eftimakis. To use it, the Figlet freeware is needed. To find Figlet and the 'eftiwall' font (or any other Figlet font), ftp to: ftp.nicoh.com/pub/figlet -- Official Figlet site !!! __________ ___ ___ |Look Here| '/_\ /\#/\ |__________| (o o) /(o o)\ -----||-----ooO--(_)--Ooo-ooO--(_)--Ooo ( ( ( )) ) ) ) (( ( ( ( ___o___) '. ___ .' | |====O ' (> <) ' |_____| --ooO-(_)-Ooo-------------------- ( ( ( |"| ,------. '. ___ .' _|_|_ | Hi ! | ' (> <) ' (o o) _)-----' -ooO--(_)--Ooo-ooO--(_)--Ooo------- ,---------------------------. _ | (c) Michel Eftimakis 1995 | ... _|_|_ __MMM__ `--------------------------(_ (o -) (o o) (o o) ---------------------------ooO--(_)--Ooo-ooO--(_)--Ooo-ooO--(_)--Ooo- ====================================================================== [OTHERS] __m____m___ Dwarf spying at the wall. oo --m--->--m-- Alain Prost spying at the wall. ___m_O_m___ Cyclops spying at the wall. __ || ___m_oo_m___ Man using a hat spying at the wall. oo ___m_oo_m___ Four-eyes spying at the wall. ___m_@^@_m___ man with glasses spying at the wall. _m_oo_m_m_oo_m_ Twins spying at the wall. _m_oo_mm_oo_m_ Siamese Twins spying at the wall. ++ /\ ___m_oo_m___ Priest spying at the wall. ____ | | ------ --m--oo--m-- Yet another man with a hat spying at the wall. --m--xx--m-- Dead cartoon spying at the wall. ----------- | | | (O) | Spying through a hole on the wall. | | ____________________________________ Spying through the wall II. |__|__|__|__|__|__|__|__|__|__|__| __|__|__|__|__|__|..|__|__|__|__| _|__|__|__|__|__|__|__|__|__|__|__| |__|__|__|__|__|__|__|__|__|__|__|__|_ |____|____|____|____|____|____|____|____|____|____|____|____|____ ____|____|____|____|____|____|____|____|____|____|____|____|____| __|____|____|____|____|___|_ ____|____|____|____|____|__ |____|____|____|____|___| (\.-./) _|____|____|____|___|___|_ ____|____|____|____|____|_ = (^ Y ^) = _|____|____|____|____|__ |____|____|____|____|____|___ /`---`\ __|____|____|____|____|____| __|____|____|____|____|____|_U___|_U|____|____|____|____|____|_ |____|____|____|____|____|____|____|____|____|____|____|____|____ __|____|____|____|____|____|____|____|____|____|____|____|____|_ The same magnified o o\ Soldier spying at the wall. --m-------- __m_oo_?__ Cap. Hook spying at the wall. __m_oo__ One-handed spying at the wall. _______oo______ Wall spying at the wall. _______________ ____________ spying at the wall (Upside down). w oo w __m__oo__m__ Spying the grass from the wall. WWwWwwwWwwWW .. XxXxXxmxXxXmXxXxXxXxXxXxX Spying at the Sobibor wall. ------------------------- ___ m_oo_m__ Spying at the (remains of) Berlin wall. _|__ |__|__|__| |__|_ _|__|__|_ _|__|_ _|__|__| |__|__| _|__|__|_ | E | Spying at the right side off the wall. ( o| > ( o| | E | \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ __m__oo__m__ Spying in the rain at the wall. \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ ___________ \ \/ | \ \ \ | J ___m__oo__W_______ Spying with an umbrella in the rain at the wall. __m_O_O_m___ Happy to spy at the wall. `-' ====\ \, O ___m_o_o_m___ Sir Isaac Newton spying at the wall. , >----O----> ___m_o_o_m___ William Tell's son spying at the wall. ----------------- Baby spying and falling off the wall. _ \ / :^O--< / \_ _ _ w(. .)w / O \ ----------------- Baby spying and falling off the wall. _ (but mom is watching...) \ / :^0--< / \_ ___ |---| | /O --m-----m-- LOG spying over wall. W ___m_o_o_m___ King spying at the wall. + ___m_o_o_m___ Queen spying at the wall. _________0-n_________________ Key forgotten for someone that was spying at this wall. _ ______m_/ \_m___________ Spying someone spying at the wall. \\ // (backwards...) | / \ / \ _____ | _ | |_/ \_| __m__|_____|___m__ Telebras logo spying at the wall. ____ / \ (. .) | \/ | \----/ |\__/| _.---.__|____|__.---.____Giant spying at the wall (there are some people UUUU UUUU that don't like to be anonymous...) _____________ _________/____________/|_______ Chip spying at the wall. ||||||||||||| _______ __________( 12:08 )__________ Digital watch spying at the wall. ----------------------- Cave crawling clan spying / under the wall. ___O\ /> \ ##### ( O O ) ------M-------M--------- Person hanging on for dear life while spying at a suspended wall. ------------------------ _// \\_ (_/ \_) /\___/\ | o o | __\_^_/__ (__/ \__) _| . |_ ___(__\___/__)____ Teddy bear spying at the wall. xWvoKfV0zI+m0tf i45BmbosrLiv1mz GYrjUruv39gzitL SIRfEJAgAS6PTfO ________________ PGP Signature spying at the wall. O \/ #|_ (_| ___###\.______| |___ Watching TV and spying at the wall. /O^O\ -------------------- Using a binocular for spying at the wall. ___ ___ // \/0\/ \\ //\__/-^-\__/\\ // \\ -------------------------- The same, seen through a binocular. ()()()()()()()()()()()()() -------------------------- No spying, barbed wire coils on top. __________p^o_________ One-armed person using a binocular for spying at the wall, being far away. _ _ {~._.~} ( Y ) ()~*~() ____(_)_(_)____ Little teddy bear on the wall. ____________ / | | \ / | 0 | \ / | /T\| \ / ------ \ / \ \ \ -------------------------- Swinging, & spying at the wall. O O O O < < < < /\ /\ /\ /\ ----------------------------- Spying at the Abbey Road wall. CRVL 0,11 CRVL 0,12 CHPR L6, 0 ___ARMZ 0,13___ MEPA code spying at the wall. MOV AX, 0451H MOV DX, AX ___CALL PRINT___ 80x86 ASSEMBLY code spying at the wall. ___(member '(A B C D 1 (A B)) A)___ LISP code spying at the wall. (but it returns `t') ' ` ---------m-O-O-m--------- man with glasses spying at the wall. (but the glasses are falling down...) \ \ @^@ ___,___,____,____ ___,___,____,____ / / / / /__,___,___,___,/__ /__,___,___,___,/__ |______m_o_o_m__|____ ___|______________| ____|____|____|____|_\ /___|____|____|____| __|____|____|____|____\ |_|____|____|____|_ ____|____|____|____|___\ /___|____|____|____| __|____|____|____|____|_| __/__|____|____|____|__ ____|____|____|____|____|\/__|____|____|____|____| __|____|____|____|____|____|____|____|____|____|____| Spying upon the Berlin wall. \0/ 0 / \ ___________ Man (Discreetly) spying on the wall. | | | | | o____ o____ o____ o____ o____ o____ |_3D_| |_3D_| |_3D_| |_3D_| |_3D_| |_3D_| | | | | | | (__) (_|) (__)| (__) | (__) |(__) (|_) (oo) (oo) (oo)| (oo) | (oo) |(oo) (oo) m|\/ m m \/ m m \/ m m \/ m | m \/ m m \/ m m \/ m /""""""/""""""/""""""/""""""/""""""/""""""/""""""/""""""/""""""/| H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H| H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H| H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H""""""H/ LS """"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""" 3D cows spying at the wall. o |~~~| /\_ _| | \__`[_ | Playing the piano and spying at the wall. ][ \,/|___| -------------------- //O\\ /|\ (o-"= Playing guitar and spying at the wall. / \ ---------------------- _________________________________ |' Please, '| | don't shoot the piano player, | | he is doing his best. | |_________________________________| o _______________________________ /\_ _| | | _\__`[____________|___________________| ] [ \, ][ ][ ------------------------------------------- Playing the grand piano with a banner and spying at the wall. |\ |\ ____|\__|_________|\\___|___________|___|____________|\_|__ ____|/__|________@__\|__|____O______|___|___@________|__|__ ___/|___|___|________|__|___|______@____|__|____@____|__|__ __|_/_\_|___|_______@___|___|___________|__|___|____@___|__ __m____\|/__|___|___________|___|___________|__|___|________|__m__ / O | Music spying at the wall. _ / ) @| ?\ ._-_. _____________________@| ?\\ +|\G/|+ | ____________________@| ?\\\ +|\./|+ || O o o o =|= | =@| ?\\\\ +|\./|+ || O o o o | =|= | -- ==== `|H|' ||______________________||\ \\\ |a| |________________________| \ \\\ |H| ||MM88MM<<<| @ ## Y Y Y Y ### |O O| |O O| (0.0) -----\"/-----------\"/-------#####-------------+ ### | | Hoo!Hoo!Hoo!... Santa Claus and his reindeers spying at the wall. _________ ___|___ | \ | \ | | \ | \ | _______|___|___|__________ Kanji for rain spying at the wall. _________8______________ Snowman spying at the wall. (too small?) O========== ______m_W_m_____________ Pinoccio spying at the wall. (He's saying "I'm not spying.") ====================================================================== ** END OF DICTIONARY